Accueil  CalendrierCalendrier  FAQFAQ  RechercherRechercher  MembresMembres  GroupesGroupes  S'enregistrerS'enregistrer  ConnexionConnexion  

Poster un nouveau sujet
Répondre au sujet

_____________génothérapie 1403259775-deso
d e s o x y r i b o s e

PSEUDO : qualsy!!!!!!!!!! i am the man
CRÉDITS : le petit staff mignon de pulsar
ÂGE : 22


_____________génothérapie Empty
Sujet: _____________génothérapie   Mar 27 Mai - 16:21

    aatgaatggac cgccgctcg attcgcacggttcatt cccagttcttcactctaacg gtcccgc gaagaagata aagacatctc tcctaaagtc gttggtttctc gttcacttt cgctgcctgc gagggaacat aggaacat tggcgcaaa atgagcggg caaaattcgcc gaaaatcgc gtatcataatt gcagcttatctga tagcccggca
    ㅡ désoxyribose

éternel mourrant
+ asexué
••• PULSÉEN, QUE PENSES-TU DE TA CHÈRE GALAXIE ? née pour faire perdurer cytosine dans pulsar se reconnait  car le même but il se sont partagés
••• ET LES AUTRES HABITANTS ? COMMENT LES VOIS-TU ? EST-CE RÉELLEMENT L'HARMONIE ENTRE VOUS ? prétendre l'harmonie est surfait - cytosine est en symbiose avec les pulséens
••• PAS TROP DIFFICILE LA VIE SUR PULSAR, DIS MOI ? elle l'est elle-même déjà bien assez
••• TON AVIS SUR VOTRE POLITIQUE ? tout est bien trop dangereux
••• ET LES HUMAINS, CES DRÔLES DE CRÉATURES, COMMENT LES REÇOIS-TU ? MÉFIANT OU ACCUEILLANT ? UN AVIS QUELCONQUE SUR EUX ? humains comme pulséens sont créées pour perdurer et cytosine voit en eux d'autres cœurs à soigner
••• QUEL SOUHAIT FAIS-TU AUX ÉTOILES DU CIEL DE TA GALAXIE ? perdurer pour faire exister
••• VAS-TU BRILLER, PULSÉEN ? il fera briller
la division cellulaire est le
mode de multiplica
tion de toute cellule.
mes deux mondes immondes ;
parois amorphes – plaies difformes
béantes ; d’ébullitions bulbaires
d'explosions éphémères
déchirement amer
d'êtres chers

siamois ; ainsi séparés
fusionnés ; symbiose assassine
jumeaux ; de la même mère clonés
et par d'autres flots – amniotiques
vers d'autres infinités

le mal en moi surmonté ;
pour s'offrir à des corps – étrangers
qui en moi sommeillaient ;
prostitution de procréation
régénération par destruction
mille morceaux de moi
sacrifiés ;

le peu de moi en toi ;
qui orphelin de mes confins
s'éveille enfin ;
et d'une sainte transe éteint
tes miasmes assassins

de ses monstrueuses méioses
naît le vivant ; paroxysme
de celui qui n'a jamais été

* * *

et moi je pourris - meurtri par la vie qui à moi interdite s'effrite le long de mes parois atrophiées abandonnées
et moi à force de donner – et destiné à faire perdurer je ne peux que m'effacer et me décomposer – déstructuré désagrégé
et moi universel – esclave de vos vies éternelles – remplace votre réel de ma vie artificielle

* * *

et déjà s'offrir à elle comme un instinct qui maternel affecte et infecte ma vitalité
de cette vicieuse infirmité nommée sacrifier


glass tube + seed of life

1 ;
il n’y a rien – prophase métaphase anaphase télophase
prophase métaphase anaphase télophase organisme en création suite sans cohésion d’atomes en collision en perpétuelle mutation maturation – il n’y a rien

2 ;
il n’y a rien

4 ;
prophase métaphase anaphase télophase
il n’y a rien seulement les ribosomes omniscients impatients les yeux rivés sur quelques instants fovéa floue fugace futile myopie il n’y a rien prophase métaphase anaphase télophase

8 ;
Il y a ce rien sensible qui gène à l’intérieur
Le rien qui grandit impartial cytosol dégoulinant d’organites s’effrite contre les parois sableuses de l’ambitieuse prophase métaphase anaphase télophase il y a ce rien qui gène à l’intérieur peut-être enfin bientôt certainement

16 ;
prophase métaphase anaphase télophase

32 ;
Toujours du rien le cytosol s’écoule sans pouvoir nourrir l’embryon qui semble inlassablement mourir toujours lentement pourrir poisseux inéluctable condensation désagrégation centromère fatidique défaite bourreau pitié il n’y a rien

64 ;
Il n’y a rien à faire maturation réticulum endoplasmique ribosome impartial mais il fait froid

128 ;
Ça fait mal enveloppe nucléaire alerte ça fait mal fécondation

128 ;
Ça fait mal enveloppe nucléaire alerte ça fait mal fécondation

128 ;
Ça fait mal enveloppe nucléaire alerte ça fait mal fécondation

128 ;
Ça fait mal enveloppe nucléaire alerte ça fait mal fécondation choc anaphylactique exécution dénaturation injection thérapie génique virus substitution adénine thymine ça fait mal enveloppe nucléaire alerte ça fait mal fécondation prophase métaphase anaphase télophase codon stop

1024 ;
Il n’y a rien – il n’y a rien
Prophase métaphase anaphase télophase

2048 ;
Ça fait mal mais tout va bien
Prophase métaphase anaphase télophase tout va bien prophase métaphase anaphase télophase ça fait mal mais tout va bien félicitations tout va bien il n’y a rien

4096 ;

8192 ;

16384 ;

32768 ;

65536 ;
Quelque chose ne va pas mais tout va bien – ribosome aux yeux géants fixe les infinités transformées terrifiant tératome totalitarisme dictateur c’est le bourreau – mais il n’y a

131072 ;
Ils veulent arrêter mais ils n’y voient aucun intérêt
Il n’y a que d’interminables monstrueuses microtubules il n’y a qu’un prophase métaphase anaphase télophase

262144 ;
Il n’y a rien – juste beaucoup de vide
De vies avides

524288 ;
Il n’y a que l’utérus béant du monde géant

1048576 ;
est-ce que les images macrophages – est-ce que

2097151 ;
Le vide envahit ; il y a la peur aussi qui grandit mais despotique acide y-aminobutyrique il faut grandir pourquoi certainement

4194304 ;
Il n’y a rien

8388608 ;
Il n’y a rien

16777216 ;
Il n’y a rien – je crois

1073741824 ;
Prophase métaphase anaphase télophase – par pitié
Pitié piètre cancer généralisé la gangrène s’installe métastasée évolue dans les contrées orphelines de toute volonté prophase métaphase anaphase télophase désolé il n’y a rien –

2147483648 ;
Je déteste les ribosomes

4294967292 ;
Parce qu’il y a les déchirements de la poche amniotique qui s’écoule dans le vide atroce mécanique des fluides soumission absolution oublie oublie oublie oublie oublie JE VEUX ARRETER prophase métaphase anaphase télophase

8589934584 ;
j’ai arrêté de respirer mais je n’ai jamais commencé donc tout a continué j’ai considéré

17179869168 ;

34359738336 ;
J’ai continué mais peut-être que je ne peux rien changer alors j’ai arrêté d’y penser cependant

68719476672 ;
Il n’y a rien j’espère

137438953344 ;
Alors j’ai arrêté certainement –

274877906688 ;

549755813376 ;

1099511626752 ;
J’ai mal mais rien a changé alors j’ai cependant essayé ainsi de soigner tout d’abord

2199023253504 ;
Le vide grandit et j’étouffe de moins en moins –
Je me trompe certainement j’en suis sûr

4398046507008 ;
Ça fait longtemps que les ribosomes – codon stop
Prophase anaphase métaphase télophase – je crois

8796093014016 ;
Normalement car

27592186028032 ;
Je crois ; décapitation pardon désolé douleur décadente j’ai essayé

35184372056064 ;
Je crois que j’existe

70368744112128 ;
Mais cytosine atroce machine à la fatidique mécanique assassine

140737488224256 ;
Je crois – traitre à la vie
Je crois

281474976448512 ;
télophase anaphase métaphase prophase
que ne j’ai plus très envie d’essayer

562949952897024 ;
Au début
Il n’y avait rien

qualsy ㅡ 16 ㅡ symbios ; pokémon ㅡ erreur de parcours
Voir le profil de l'utilisateur
CRÉDITS : sexy mirmir + awesome bro font des miracles
ÂGE : 24


_____________génothérapie Empty
Sujet: Re: _____________génothérapie   Mar 27 Mai - 16:29


tu es né sur pulsar ! maintenant que tu t'es présenté à lui, le roi te remet ton registre à étoiles et te souhaite une étincelante existence parmi les astres.
Bonne chance, et surtout, brille.

n'oublie pas de recenser ton avatar !

je viens d'écrire cytosine sur google pour prendre le formulaire de validation si tu vois à peu près
Voir le profil de l'utilisateur

Page 1 sur 1

Permission de ce forum:Vous ne pouvez pas répondre aux sujets dans ce forum